juaniturrios juaniturrios
  • 02-02-2018
  • History
contestada

My mother’s voice was like a cool, dark room in summer-peaceful, soothing, quiet

Respuesta :

SingleXxXxXx
SingleXxXxXx SingleXxXxXx
  • 02-02-2018
My mom's voice is usually like a dark room during a blizzard in winter. Very disturbing, opposite of soothing, and excessively loud. 








(my way of saying, what's the question?)
Answer Link

Otras preguntas

Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
In which system of government would states function independently of each other?
i need help with this question
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
when Jefferson took office he did what
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa