darkwolft22 darkwolft22

01-03-2017
Mathematics

contestada

3x=-4y+10
4×+3y=11

I do not understand how to do this to solve for c and y

Respuesta :

nicnic02 nicnic02

01-03-2017

Download math papa it really helps

Answer Link

Otras preguntas

akrjrot5oooiwieiiwjwje

The owners of a recreation area are filling a small pond with water. Let W be the total amount of water in the pond (in liters). Let T be the total number of mi

A construction crew has just built a new road. They worked for 3 weeks. They built the road at a rate of 7.68 kilometers per week. How many kilometers of road d

Transform AABC by the following transformations:• Reflect across the line y = -X• Translate 1 unit to the right and 2 units down.7BА)-6521-8-7-6-54-3-2-1027583-

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Your team has carefully researched and selected two possible painting companies. Pro Painters charge $200 per hour plus $6000 in material fees. Illusion Ltd ch

The following 10 scores were input in the gradebook for Prof. Hughes's class. 76, 77, 78, 80, 87, 88, 93, 97, 97, 194 Identify all values that are outliers. If

How is the energy source for photosynthesis different from the energy source for cellular respiration

Hi could you help me with my homework Number 1

Linear Relationships Study Guide 1.) Select all the equations for which (-6, -1) is a solution. Show your work to prove that each solution is correct. A.y= 4x +