makhiyajackson2 makhiyajackson2
  • 01-07-2021
  • Mathematics
contestada

What is the volume of the cylinder to the nearest whole number?

What is the volume of the cylinder to the nearest whole number class=

Respuesta :

Аноним Аноним
  • 01-07-2021

Answer:

[tex]{ \bf{volume = \pi {r}^{2}h }} \\ = 3.14 \times {7.5}^{2} \times 20 \\ { \tt{volume = 3534.3 \: {cm}^{2} }}[/tex]

Answer Link

Otras preguntas

how do you know 8 thousandths is less than 1 hundredths
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
What is the additive inverse of -4a
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the geometric mean between 6 and 20?
why is it critical to your cells to be near capillaries
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120