joshhh70 joshhh70
  • 01-05-2019
  • History
contestada

State government have the power to?

State government have the power to class=

Respuesta :

Loveleh
Loveleh Loveleh
  • 01-05-2019

Answer: Establish Local Governments.

Explanation:

Regulate interstate trade is the federal gov't.

Declaring war is also federal,

And Negotiating Treaties is also the national gov't's job.

Answer Link
sprinkles1222
sprinkles1222 sprinkles1222
  • 01-05-2019

Establish local governments!

Hope it helped

Answer Link

Otras preguntas

Can things of aluminum have a greater mass than things made of iron?
A major weakness of the new constitution was the bill of rights. a. True b. False
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Some puritans wanted to separate from the Church of England
Which type of intelligence allows people to use their vision to develop mental images?
Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re
Need Help Fast 33 points please Factor x2 + 10x – 18.
What is the value of x?
Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a
which of the following statements agrees with the second law of thermodynamics