juliaelizabeth1718 juliaelizabeth1718
  • 03-10-2018
  • Spanish
contestada

You can travel by boat between Mazatlán and Los Cabos.

True
False

Respuesta :

Emotitude
Emotitude Emotitude
  • 03-10-2018
That is true............
Answer Link
vazbri8
vazbri8 vazbri8
  • 03-10-2018
The answer is true si
Answer Link

Otras preguntas

what is 40 percent of 85?​
What is the measure of x? 344 43 172 86
Can someone help me explain on how to do this
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
What do you think telephone will look like in 20 years? 3 or more sentences. I’ll mark brainless if you do 3 or more sentences
Which state is further north a Wisconsin b Michigan c Minnesota d Maine
does anyone need help with any homework for any class, if so then I am free to help you
I need help on this math its timed
Which expression is equivalent to the expression shown below? 11/12 divided by 2/9 A:11/12•9/2 B:12/11•9/2 C:12/11+2/9 D:12/11+9/2
A bag contains five red marbles 3 blue marbles and 7 yellow marbles into remodels which radio can be used to compare the yellow my bus to the blue marbles